Abstract

Truncated dominant negative forms of CEBPB and CEBPD, and cell-penetrating forms thereof are described. Methods for using the truncated dominant negative forms of CEBPB and CEBPD proteins, and cell-penetrating forms thereof, for decreasing viability of neoplastic cells and treating cancer in a subject are also described.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals
• A61K 38/16 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

Abstract

Apparatus and methods are disclosed to assess tissue properties, especially those of lung tissues. By measuring impedance in response to electrical stimulation, a variety of properties can be deduced including spatial location of damaged tissue, presence of epithelial cells and function of diseased tissue. To these ends, a probe (10) with electrodes (12, 14, 16, 18) connected to an impedance analyzer (20) was developed for assessing tissue (22) function. By applying voltages and/or currents, different information can be determined. In another embodiment, such a probe can be used for electroporation to evaluate the location of genetic molecules (e.g., RNA, DNA, or gene-editing machinery) and/or encourage their transport across different layers of tissue (FIG. 11).

IPC Classes  ?

• A61B 1/267 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor for the respiratory tract, e.g. laryngoscopes, bronchoscopes
• A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
• A61B 5/08 - Measuring devices for evaluating the respiratory organs

Abstract

Described herein is a fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2. Also described are methods for treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.

IPC Classes  ?

• C07K 19/00 - Hybrid peptides
• A61K 47/68 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61P 31/14 - Antivirals for RNA viruses
• C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals
• C07K 16/10 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
• C07K 14/165 - Coronaviridae, e.g. avian infectious bronchitis virus

Abstract

The present disclosure provides systems, compositions, and methods for nucleic acid modification. More particularly, the present disclosure provides systems comprising a TnpA protein, a TnpB protein, an IscB protein, or a combination thereof, and methods using thereof.

IPC Classes  ?

• C12N 9/22 - Ribonucleases
• A61K 39/02 - Bacterial antigens

Abstract

Disclosed are novel heterobifunctional compounds that induce p53Y220C acetylation, and methods for use of such compounds in the treatment of p53Y220C-mediated diseases.

IPC Classes  ?

• C07D 487/16 - Peri-condensed systems
• A61K 31/403 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
• A61P 35/00 - Antineoplastic agents

Abstract

Compositions, and methods of treating a subject using the compositions, for treating obesity, reducing body weight, treating chronic inflammation associated with obesity, reducing focal adiposity, and improving metabolism. The compositions include a complex comprising cationic PAMAM generation 3 (P-G3) and human serum albumin (HSA). The complex may be a cfRNA or cfDNA scavenger.

IPC Classes  ?

• A61K 47/59 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
• A61K 31/74 - Synthetic polymeric materials
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61P 3/04 - Anorexiants; Antiobesity agents
• B82Y 5/00 - Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
• C07K 14/705 - Receptors; Cell surface antigens; Cell surface determinants

Abstract

Methods of crosslinking collagenous tissue include contacting the tissue with a sugar; and illuminating the tissue with any one or more of UV-A light or a femtosecond laser, the illuminating being performed under conditions sufficient to give rise to crosslinking within the tissue is a method of treating a tissue of a cornea. Method of treating a tissue of a cornea include restricting oxygen replenishment of the tissue; contacting the tissue with a sugar; and illuminating the tissue with at least one of UV-A light or a femtosecond laser, the illuminating being performed under conditions sufficient to give rise to crosslinking within the tissue. Methods of treating a collagenous tissue include contacting the tissue with a sugar; and illuminating the tissue with any one or more of UV-A light or a femtosecond laser, the illuminating being performed under conditions sufficient to give rise to crosslinking within the tissue.

IPC Classes  ?

• A61K 31/70 - Carbohydrates; Sugars; Derivatives thereof
• A61N 5/06 - Radiation therapy using light

Abstract

inter aliainter alia, compounds to modulate GPX4 activity. Also provided are pharmaceutical compositions containing such compounds. Further provided are methods for treating or ameliorating the effects of a cancer in a subject, methods of modulating GPX activity in a subject, methods of inducing ferroptosis in a cell, and methods for treating or ameliorating the effects of a cancer in a subject using the compounds or composition in combination with other therapeutic agents.

Abstract

1212223223232332222223333 3234323312333432323223322223232322332323223222, -F, -Cl, -Br or -I, or a pharmaceutically acceptable salt thereto.

Abstract

Compositions and methods for treating insulin resistance, reducing blood glucose level, increasing insulin tolerance, and treating diabetes. The methods include administering the composition to a subject. The subject may express insulin receptor with site-1 binding-deficient mutations or insulin-desensitized insulin receptor. The composition includes a synthetic peptide of 18-35 amino acid residues in length. The composition may include insulin or an analog thereof. The synthetic peptide has a linker region and a component 2 region. The synthetic peptide may also have a component 1 region. A method of activating PI3K-AKT pathway without activating MAPK pathway in a cell includes administering the synthetic peptide to the cell. Uses for the synthetic peptide include the treatment of insulin resistance, the reduction of blood glucose level, increasing insulin tolerance, treating diabetes, and the manufacture of a medicament for these purposes.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals
• A61K 38/16 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

Abstract

Natural antibodies are an integral part of innate humoral immunity yet their development and polyreactive nature are still enigmatic. Here it is shown that characteristic monoclonal natural antibodies recognize common chemical moieties or adducts, supporting the view that polyreactive antibodies may often correspond to anti-adduct antibodies. Moreover, the development of IgM and IgG to 81 ubiquitous adducts from birth to old age was examined. Newborn IgM only reacted to a limited number of consensus determinants. This highly restricted neonatal repertoire abruptly diversified around 6 months of age through the development of antibodies to environmental antigens as well as age-driven epigenetic modifications. In contrast, the IgG repertoire was diverse across the entire lifespan. The studies set forth reveal an unrecognized but significant component of humoral immunity directed to common adducts.

IPC Classes  ?

• G01N 33/569 - Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses

Abstract

The subject matter described here relates to bispecific antibodies capable of modulating T-cell activity, wherein the two arms of the bispecific antibody are against CD3 and SLAMF6, against CD45 and SLAMF6, or against CD43 and SLAMF6.

IPC Classes  ?

• C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
• A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum

Abstract

Implementations present convolutional neural network based spectral registration (CNN-SR) techniques that achieve efficient and accurate simultaneous frequency-and-phase correction (FPC) of magnetic resonance spectroscopy (MRS) data. Magnetic resonance spectroscopy research and clinical applications have provided invaluable information on the metabolic state of the brain. However, the data collection and analysis can be improved. For example, MRS data often undergoes correction after the data is collected, such as frequency correction and/or phase correction. Implementations provide CNN-SR techniques to correct frequency and phase offset at the same time (e.g., simultaneously). The CNN-SR techniques leverages properties of a CNN that exploit spatial and temporal invariance in recognition of features, such as the overall shape of the signal and its peaks. Some embodiments perform model training in multiple phase and implement different training techniques (e.g., supervised training, unsupervised training, etc.) using different data sets.

IPC Classes  ?

• G01R 33/485 - NMR imaging systems with selection of signal or spectra from particular regions of the volume, e.g. in vivo spectroscopy based on chemical shift information
• A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
• A61B 6/00 - Apparatus for radiation diagnosis, e.g. combined with radiation therapy equipment
• G01R 23/16 - Spectrum analysis; Fourier analysis

Abstract

The subject matter described herein relates to a method of treating or preventing prostate cancer in a subject with administration of a composition comprising a Nuclear Receptor Binding Set Domain Protein 2 (NSD2) inhibitor.

IPC Classes  ?

• A61K 45/00 - Medicinal preparations containing active ingredients not provided for in groups
• A61P 35/00 - Antineoplastic agents
• A61K 31/495 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two nitrogen atoms as the only ring hetero atoms, e.g. piperazine
• A61K 31/498 - Pyrazines or piperazines ortho- or peri-condensed with carbocyclic ring systems, e.g. quinoxaline, phenazine
• A61K 31/7105 - Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
• A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum

Abstract

Compositions and methods for identifying an RNA regulatory element on a target gene, and for treating a disease with a disease-associated genetic variant. The compositions include a vector for expressing the target gene and a first fluorescence signal that may be a green fluorescent protein (GFP), and a second fluorescence signal wherein the nucleic acid sequence encoding the target gene is between the first fluorescent signal and the second fluorescent signal; a vector for expressing enzymatically dead Cas13 (dCas13) and a third fluorescence signal; and a vector for expressing a guide RNA (gRNA), wherein the nucleotide sequence of the gRNA is complementary to regions of the target gene comprising RNA regulatory elements.

IPC Classes  ?

• C12Q 1/686 - Polymerase chain reaction [PCR]
• C12N 15/11 - DNA or RNA fragments; Modified forms thereof

Abstract

A photo-switchable nanocrystal can be provided which can include solely one or more inorganic elements. Further, a method for synthesizing photo-switchable nanocrystal can be provided which can utilize solely inorganic elements. For example, the fully inorganic element(s) can comprise lanthanide ion (Ln3+)-based phosphors. Further, the nanocrystal can be photostable and/or does not photodegrade with light excitation cycles.

IPC Classes  ?

• A61K 41/00 - Medicinal preparations obtained by treating materials with wave energy or particle radiation
• A61N 5/06 - Radiation therapy using light
• C01F 17/36 - Compounds containing rare earth metals and at least one element other than a rare earth metal, oxygen or hydrogen, e.g. La4S3Br6 halogen being the only anion, e.g. NaYF4
• C09K 11/77 - Luminescent, e.g. electroluminescent, chemiluminescent, materials containing inorganic luminescent materials containing rare earth metals
• G02F 1/00 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulating; Non-linear optics

Abstract

A method of treating cancer in a subject using a kinome and/or phosphorylome analysis approach, a SPHINKS computational analysis, or a combination thereof to target master kinases driving the cancer state.

IPC Classes  ?

• G16B 20/00 - ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
• A61K 41/00 - Medicinal preparations obtained by treating materials with wave energy or particle radiation

Abstract

The present disclosure provides compositions and methods of treating or preventing neurodegenerative diseases, including tau-related diseases or tauopathies. A variant or mutant of a heat shock protein, such as an Hsp70 family member protein, may be used in the present method. Alternatively, a modulator of a heat shock protein may be used.

IPC Classes  ?

• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 31/7088 - Compounds having three or more nucleosides or nucleotides
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA

Abstract

in vitroFaecalibacterium rodentiumErysipelotrichaceae Erysipelotrichaceae family in the subject may provide a similar result. ILC3 or IL-22 blockade (alone or combined with Th17 cell administration or induction if not already present in the subject), may further provide a similar result, protecting against metabolic disease.

IPC Classes  ?

• A61K 41/00 - Medicinal preparations obtained by treating materials with wave energy or particle radiation
• A61P 3/04 - Anorexiants; Antiobesity agents

Abstract

Exemplary system, method and computer-accessible medium can be provided to monitor electroencephalography (EEG) data from the patient during an emergence from a general anesthesia previously provided to the patient, and predicting neurocognitive impairment based on a slope of EEG power. The neurocognitive impairment predicted can be delirium or it may be a predictor of long-term impairment such as Alzheimers. Further, the system and method can be used to direct a medical intervention based on the preditcted neurocognitive impairment.

IPC Classes  ?

• A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
• A61B 5/291 - Bioelectric electrodes therefor specially adapted for particular uses for electroencephalography [EEG]
• A61B 5/374 - Detecting the frequency distribution of signals, e.g. detecting delta, theta, alpha, beta or gamma waves
• G16H 20/10 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to drugs or medications, e.g. for ensuring correct administration to patients
• G16H 30/20 - ICT specially adapted for the handling or processing of medical images for handling medical images, e.g. DICOM, HL7 or PACS

Abstract

Methods for preventing, reducing development of, or treating a peripheral neuropathy in a subject is provided, including taxane-induced peripheral neuropathies, by administration of mesencephalic astrocyte-derived neurotrophic factor MANF or nucleic acids encoding MANF are provided. Methods of treating extant peripheral neuropathies, peripheral reducing taxane-induced macrophage activation, and neuropathy-associated peripheral pain are provided.

IPC Classes  ?

• A61P 25/02 - Drugs for disorders of the nervous system for peripheral neuropathies

Abstract

A device for mechanical securement to hard tissue of a subject, the hard tissue having an end surface defining a direction of curvature such that over at least a portion of the surface, a total curvature of at least 180 degrees is defined, the device comprising a body portion comprising at least four contact points, three contact points of the four contact point span over 180 degrees of total curvature of the end surface in a plane defined by the three contact points, and a fourth contact point outside the plane, the four contact points providing mechanical securement of the body portion to the hard tissue.

IPC Classes  ?

• A61F 2/32 - Joints for the hip

Abstract

The present disclosure provides systems, methods, and compositions for modifying a target nucleic acid. Particularly, the present invention relates to a polypeptide comprising a single subunit of a reverse transcriptase and a sequence-specific nuclease for use in prime-editing modification of a nucleic acid.

IPC Classes  ?

• C07K 14/155 - Lentiviridae, e.g. human immunodeficiency virus (HIV), visna-maedi virus, equine infectious anaemia virus
• C07K 14/195 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
• C12N 9/22 - Ribonucleases
• C12P 19/34 - Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Abstract

A bioengineered human tissue platform that allows quantitative studies of the effects of radiation, and cryoinjury on engineered cardiac tissue and engineered bone marrow.

IPC Classes  ?

• C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
• C12M 1/16 - Apparatus for enzymology or microbiology containing, or adapted to contain, solid media
• C12M 1/18 - Multiple fields or compartments
• C12M 3/02 - Tissue, human, animal or plant cell, or virus culture apparatus with means providing suspensions
• C12M 3/08 - Apparatus for tissue disaggregation
• C12N 13/00 - Treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
• G01N 1/28 - Preparing specimens for investigation
• G01N 21/00 - Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light

Abstract

Described are lipopeptides that inhibit coronavirus fusion to a host cell. Thus a therapeutic for treating or preventing the common cold is described along with methods of inhibiting and/or treating an alphacoronavirus infection. The lipopeptides comprise a peptide unit comprising an amino acid sequence having a high degree of sequence identity to a sequence from the C-terminal heptad repeat of a betacoronavirus S protein, such as that of SARS-CoV-2.

IPC Classes  ?

• A61K 38/16 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
• A61P 31/00 - Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics

Abstract

Provided herein are methods, compositions, systems and kits for testing immune responses, safety, and efficacy of vaccines. In particular, the methods, compositions, systems and kits of the present invention test immune responses, duration of the immune responses, dose responses and age dependencies in cellular components of lymph nodes, other lymphoid tissues, mucosal tissues, barrier tissues, intestinal tissues, pulmonary tissues, and other solid tissues to vaccines after exposure in cell culture and tissue slices.

IPC Classes  ?

• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
• C12N 5/078 - Cells from blood or from the immune system
• G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
• C12Q 1/6804 - Nucleic acid analysis using immunogens

Abstract

The subject matter described here relates to an enhancer specific to a subset of cholinergic neurons, that can control gene expression in a highly neuron-specific manner, wherein the enhancer is compatible with AAVs packaging and can induce gene expression or knockdown in cholinergic neurons in both post-natal and adult subjects.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 38/18 - Growth factors; Growth regulators
• C12N 15/864 - Parvoviral vectors
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• C12N 15/11 - DNA or RNA fragments; Modified forms thereof

Abstract

Exemplary apparatus and method can be provided for use with ultrasound imaging. The apparatus can include at least one implantable device which is configured to communicate with an ultrasound imaging system, be located by the ultrasound imaging system using ultrasound signals generated thereby to generate a location of the implantable device(s), and transmit data to the ultrasound imaging system from the location of the implantable device(s) that was located by the ultrasound imaging system. Further, it is possible to implant, into a structure, at least one device which is responsive to ultrasound signals generated by the ultrasound imaging system, locale the device(s) within the structure by the ultrasound imaging system using the ultrasound signals to generate a location of the device(s) within the structure, and transmit data to the ultrasound imaging system from the location of the device(s) that was located by the ultrasound imaging system.

IPC Classes  ?

• A61B 8/00 - Diagnosis using ultrasonic, sonic or infrasonic waves
• H04B 11/00 - Transmission systems employing ultrasonic, sonic or infrasonic waves
• H02J 50/10 - Circuit arrangements or systems for wireless supply or distribution of electric power using inductive coupling
• A61N 7/00 - Ultrasound therapy

Abstract

This disclosure to the methods for nucleic acid modification, gene targeting, and gene tagging comprising an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated transposon (CAST) system with a donor DNA comprising at least one engineered transposon end sequence and/or at least one integration co-factor protein. More particularly, the present disclosure provides systems comprising: an engineered CAST system or one or more nucleic acids encoding the engineered CAST system, wherein the CAST system comprises at least one or all of: i) at least one Cas protein, ii) one or more transposon-associated proteins, iii) at least one guide RNA (gRNA) complementary to at least a portion of a target nucleic acid sequence; and a donor nucleic acid comprising a cargo nucleic acid sequence flanked by at least one engineered transposon end sequence and/or at least one integration co-factor protein, or a nucleic acid encoding thereof.

IPC Classes  ?

• C12N 15/63 - Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

StreptococcusStreptococcus (PANDAS). Also provided are diagnostic methods for PANS (such as PANDAS) where the methods assay the levels of one or more cytokines, chemokines and/or growth factors in a sample taken from a subject.

IPC Classes  ?

• G16B 25/10 - Gene or protein expression profiling; Expression-ratio estimation or normalisation
• C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants

Abstract

Disclosed are methods, systems, devices, and other implementations, including a voltage converter system that includes two or more Active Half Bridge (AHB) converter circuits, each of the two or more AHB converter circuits connected to one or more windings of a transformer, with each AHB converter circuit including one or more switches and one or more energy storage devices. The voltage converter system further includes one or more controllers to control electrical behavior of the two or more AHB converter circuits according to normalized switching functions representing the switching states of the switches of the two or more AHB converter circuits.

IPC Classes  ?

• H02M 3/24 - Conversion of dc power input into dc power output with intermediate conversion into ac by static converters
• H02M 3/28 - Conversion of dc power input into dc power output with intermediate conversion into ac by static converters using discharge tubes with control electrode or semiconductor devices with control electrode to produce the intermediate ac
• H02M 3/325 - Conversion of dc power input into dc power output with intermediate conversion into ac by static converters using discharge tubes with control electrode or semiconductor devices with control electrode to produce the intermediate ac using devices of a triode or a transistor type requiring continuous application of a control signal
• H02M 3/335 - Conversion of dc power input into dc power output with intermediate conversion into ac by static converters using discharge tubes with control electrode or semiconductor devices with control electrode to produce the intermediate ac using devices of a triode or a transistor type requiring continuous application of a control signal using semiconductor devices only
• H02M 1/00 - APPARATUS FOR CONVERSION BETWEEN AC AND AC, BETWEEN AC AND DC, OR BETWEEN DC AND DC, AND FOR USE WITH MAINS OR SIMILAR POWER SUPPLY SYSTEMS; CONVERSION OF DC OR AC INPUT POWER INTO SURGE OUTPUT POWER; CONTROL OR REGULATION THEREOF - Details of apparatus for conversion
• H02M 1/08 - Circuits specially adapted for the generation of control voltages for semiconductor devices incorporated in static converters
• H02M 1/084 - Circuits specially adapted for the generation of control voltages for semiconductor devices incorporated in static converters using a control circuit common to several phases of a multi-phase system
• H02M 1/088 - Circuits specially adapted for the generation of control voltages for semiconductor devices incorporated in static converters for the simultaneous control of series or parallel connected semiconductor devices

Abstract

Thermal management systems and methods are provided for managing thermal energy of a power converter and components thereof. In one example, a cooling jacket is coupled to a circuit board, where the cooling jacket has an inner surface that mimics a board surface profile formed by outward surfaces of a printed circuit board and electronic components thereon. Coolant fluid is provided through a coolant fluid pathway volume defined by the board surface profile and the inner surface of the cooling jacket. In another example, a cooling jacket covers an outward surface of an electronic component on a printed circuit board. The cooling jacket receives coolant fluid at an injection inlet and directs a jet of the coolant fluid toward the outward surface of the electronic component. The fluid exits the cooling jacket at an opening between the cooling jacket and a surface of the printed circuit board.

IPC Classes  ?

• H01L 23/46 - Arrangements for cooling, heating, ventilating or temperature compensation involving the transfer of heat by flowing fluids
• H01L 23/473 - Arrangements for cooling, heating, ventilating or temperature compensation involving the transfer of heat by flowing fluids by flowing liquids
• H05K 7/20 - Modifications to facilitate cooling, ventilating, or heating
• H01L 23/467 - Arrangements for cooling, heating, ventilating or temperature compensation involving the transfer of heat by flowing fluids by flowing gases, e.g. air
• G06F 1/20 - Cooling means

Abstract

The present disclosure provides compositions and vectors comprising a transgene(s) encoding more than one isoform of Crumbs homologue-1 (CRB1) (e.g., CRB1-A and CRB1-B), and compositions thereof, for use in the treatment or prevention of CRB1-related diseases and disorders (e.g., autosomal recessive retinitis pigmentosa (RP) and Leber congenital amaurosis (LCA)). In some embodiments, at least one or all of the more than one isoform of CRB1 is operably linked to a tissue-specific or cell type-specific control or regulatory element. In some embodiments, the tissue-specific or cell type-specific control or regulatory element comprises a mini promoter. In some embodiments, at least one of the more than one isoform of CRB1 comprises CRB1-A and CRB1-B.

IPC Classes  ?

• C12N 15/86 - Viral vectors
• A61K 35/76 - Viruses; Subviral particles; Bacteriophages
• A61P 27/02 - Ophthalmic agents
• C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals

Abstract

Vaccines reduce the risk developing a disease by stimulating the body's natural defenses to build protection. The subject matter described herein related to a messenger RNA (mRNA)-vaccine adjuvant comprising a glycolipid compound. Specific embodiments are directed towards a mRNA COVID-19 vaccine comprising the mRNA BNT162b2, encoding the SARS-CoV-2 spike protein, and the glycolipid adjuvant, 7DW8-5.

IPC Classes  ?

• A61K 39/215 - Coronaviridae, e.g. avian infectious bronchitis virus
• A61K 31/7088 - Compounds having three or more nucleosides or nucleotides
• A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61P 31/14 - Antivirals for RNA viruses

Abstract

Disclosed herein are lung progenitor cells that are in the form of lung organoids and methods of generating the lung progenitor cells. The lung organoids can be an important resource for treating lung disorders and injuries, studies in human lung regeneration, disease modeling, and drug target identification and validation.

IPC Classes  ?

• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
• C12N 5/07 - Animal cells or tissues
• C12N 5/0735 - Embryonic stem cells; Embryonic germ cells
• A61K 31/275 - Nitriles; Isonitriles

Abstract

PAMAM-based nanocarriers with high loading efficiency of chemotherapeutics and high cfNA binding ability enable sustained delivery of chemotherapeutics while inhibiting systemic inflammation caused by the chemotherapy. This is useful for treating both primary and metastatic tumors with attenuated cognitive impairment.

IPC Classes  ?

• A61K 31/13 - Amines, e.g. amantadine
• A61K 31/145 - Amines, e.g. amantadine having sulfur atoms, e.g. thiurams (N—C(S)—S—C(S)—N or N—C(S)—S—S—C(S)—N); Sulfinylamines (—N=SO); Sulfonylamines (—N=SO2)
• A61K 31/16 - Amides, e.g. hydroxamic acids
• A61P 7/06 - Antianaemics

Abstract

Disclosed herein are products, methods, and uses for treating, ameliorating, or delaying the progression of, and/or preventing seizures, an epileptic disease or disorder, an intellectual or developmental disability, autism, or an autism spectrum disorder associated with mutant or pathogenic Potassium Channel, Voltage Gated KQT-Like Subfamily Q, Member 3 (KCNQ3) expression. More particularly, disclosed herein are RNA interference- based products, methods, and uses for reducing or inhibiting the expression of the KCNQ3 gene and its resulting mRNA and/or protein. Even more particularly, the disclosure provides microRNA (miRNA) for reducing or inhibiting the expression of KCNQ3 and methods of using said miRNA to reduce or inhibit mutant or pathogenic KCNQ3 expression in cells and/or in cells of a subject having a genetic mutation in the KCNQ3 gene which results in disease symptoms including, but not limited to, seizures, epilepsy, intellectual and/or developmental disability, autism, or an autism spectrum disorder. Such disease symptoms, in some aspects, result from developmental and epileptic encephalopathy (DEE) attributed to various mutations in the KCNQ3 gene which result in the expression of various mutant or pathogenic forms of the KCNQ3 protein.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61P 25/08 - Antiepileptics; Anticonvulsants
• C12N 7/00 - Viruses, e.g. bacteriophages; Compositions thereof; Preparation or purification thereof
• C12N 15/86 - Viral vectors

Abstract

The present subject matter relates to techniques of a source for the preparation and capture of ultracold strontium (Sr) atoms via a dispenser-based two-dimensional magneto-optical trap (2D MOT). The disclosed system can include a vacuum system, a dispenser assembly, a laser system, and a magnetic field generator. The system is distinguished with a high atom flux of the Sr atoms with a loading rate up to 109 atoms per second.

IPC Classes  ?

• G21K 1/08 - Deviation, concentration, or focusing of the beam by electric or magnetic means
• G21K 1/093 - Deviation, concentration, or focusing of the beam by electric or magnetic means by magnetic means
• G21K 1/00 - Arrangements for handling particles or ionising radiation, e.g. focusing or moderating
• H05H 3/02 - Molecular or atomic-beam generation, e.g. resonant beam generation
• H01F 7/06 - Electromagnets; Actuators including electromagnets
• G21K 1/06 - Arrangements for handling particles or ionising radiation, e.g. focusing or moderating using diffraction, refraction, or reflection, e.g. monochromators

Abstract

Media for making esophageal organoids, methods of making an esophageal organoid using that media, and esophageal organoids produced by those methods.

IPC Classes  ?

• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• C12N 5/09 - Tumour cells

Abstract

A 3D printed structure is provided. The structure includes a composition that is formed from a mixture. The mixture includes an earth component, a fiber component, a water component, and at least one additive. The structure includes an insulation portion and an exterior support portion surrounding the insulation portion. The exterior support portion includes an earth: fib er: water weight ratio of about 65:4:32. The insulation portion includes an earth: fib er: water weight ratio of about 65:244: 1480. In some embodiments, the structure includes an interior support portion that is positioned at least partially between the exterior support portion and the insulation portion. The interior support portion includes an earth:fiber:water weight ratio of about 65: 12:67.5.

IPC Classes  ?

• B33Y 70/10 - Composites of different types of material, e.g. mixtures of ceramics and polymers or mixtures of metals and biomaterials
• B29C 64/00 - Additive manufacturing, i.e. manufacturing of three-dimensional [3D] objects by additive deposition, additive agglomeration or additive layering, e.g. by 3D printing, stereolithography or selective laser sintering
• B33Y 80/00 - Products made by additive manufacturing
• E04B 2/14 - Walls having cavities in, but not between, the elements, i.e. each cavity being enclosed by at least four sides forming part of one single element
• E04C 2/02 - Building elements of relatively thin form for the construction of parts of buildings, e.g. sheet materials, slabs, or panels characterised by specified materials
• E04C 2/16 - Building elements of relatively thin form for the construction of parts of buildings, e.g. sheet materials, slabs, or panels characterised by specified materials of foamed products of fibres, chips, vegetable stems, or the like
• F16S 1/12 - Sheets, panels, or other members of similar proportions; Constructions comprising assemblies of such members of substantial thickness, e.g. with varying thickness, with channels

Abstract

Transmembrane proteases are necessary for HPIV3 fusion protein cleavage in the human lung. HPIV3 fusion protein cleavage in the human lung is not furin dependent as previously thought, but instead is facilitated by transmembrane proteases, typically targeting TMPRSS2 expression. Serine protease inhibitors may be used in this manner to treat HPIV in a patient. Particular serine protease inhibitors shown to be effective include nafamostat, camostat, aprotinin, and leupeptin. Method of treating HPIV use serine protease inhibitors as treating agents.

IPC Classes  ?

• A61K 31/395 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
• A61K 31/164 - Amides, e.g. hydroxamic acids of a carboxylic acid with an aminoalcohol, e.g. ceramides
• A61P 31/12 - Antivirals
• A61K 31/33 - Heterocyclic compounds

Abstract

The present disclosure provides systems, methods, and compositions for prime-editing modification of c.828 splice site mutations in the peripherin‐2 gene. Particularly the present disclosure provides systems, methods, and compositions for correcting one or more disease-causing splice site mutations selected from: c.828+3A>T, c.828+1G>A, c.828+2T>C, c.828+1G>T, and combinations thereof.

IPC Classes  ?

• C12N 9/22 - Ribonucleases
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12N 15/11 - DNA or RNA fragments; Modified forms thereof
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Abstract

A biological tissue model for in vitro applications comprising a substrate including a plurality of isolated, soluble matrikines, wherein the substrate is capable of recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue. Preparing the biological tissue model includes isolating a plurality of soluble matrikines from an extracellular matrix; incorporating the plurality of soluble matrikines into a substrate; and recapitulating one or more of a microstructure, molecular composition, and biomechanical property of a native biological tissue with the substrate.

IPC Classes  ?

• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• C12N 5/02 - Propagation of single cells or cells in suspension; Maintenance thereof; Culture media therefor

Abstract

Orally-deliverable programmable bacteria cells that colonize colorectal tumors and produce diagnostic and therapeutic molecules, as well as related compositions and methods.

IPC Classes  ?

• A61K 35/74 - Bacteria
• A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
• A61P 35/00 - Antineoplastic agents
• C12N 1/20 - Bacteria; Culture media therefor
• C12N 15/70 - Vectors or expression systems specially adapted for E. coli
• G01N 33/569 - Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses

Abstract

The present disclosure relates to methods and systems for transcriptomic profiling of a biological sample and use of the transcriptomic profile for disease monitoring, responses to perturbations, and personalized therapies. In particular, the disclosure is related to methods and systems for transcriptomic profiling from host cells (e.g., small and large intestine exfoliated cells) in feces.

IPC Classes  ?

• C12Q 1/6844 - Nucleic acid amplification reactions
• C12Q 1/689 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Abstract

Examples of syringe assemblies and sets of components are disclosed for transferring a fluid sample for testing. In some examples, the syringe assembly comprises a housing, a barrel, a plunger reciprocally moveable in the barrel, a narrow tube connected to the barrel, and a metering actuator configured to control movement of the plunger at least in a proximal direction relative to the barrel. The metering actuator is configured to draw a precise microvolume of the fluid sample into a fluid chamber within the syringe assembly. In some examples, while the fluid chamber holds the fluid sample, the distal tip of the narrow tube remains covered, for example inside the housing or a reaction container. The syringe assembly is configured to expel the fluid sample from the fluid chamber into the reaction container.

IPC Classes  ?

• A61J 1/20 - Arrangements for transferring fluids, e.g. from vial to syringe
• A61J 1/22 - Arrangements for transferring fluids, e.g. from vial to syringe with means for metering the amount of fluid
• A61B 5/15 - Devices for taking samples of blood
• G01N 1/14 - Suction devices, e.g. pumps; Ejector devices

Abstract

in situin situ generated dynamic thermosets exhibit intrinsic reprocessability as well as enhanced tensile strength and creep resistance, relative to virgin plastics. This approach avoids the need for de/reconstruction and thus provides the maximum recovery of the endowed energy and materials value of the individual plastics.

IPC Classes  ?

• C07D 403/02 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group containing two hetero rings
• C07D 403/10 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group containing two hetero rings linked by a carbon chain containing aromatic rings
• C08K 5/3442 - Heterocyclic compounds having nitrogen in the ring having two nitrogen atoms in the ring
• C07D 229/02 - Heterocyclic compounds containing rings of less than five members having two nitrogen atoms as the only ring hetero atoms containing three-membered rings

Abstract

The present inhibitory polypeptides/peptides are derived from an envelope (E) protein of a coronavirus (e.g., human coronaviruses such as SARS-GoV-2). The peptides can be a component of a fusion polypeptide further comprising a cell-penetrating peptide. The peptides can comprise a sequence-defined 18- amino acid peptide with specified point mutations and can be used to treat or prevent infection by a coronavirus in a subject.

IPC Classes  ?

• A61K 39/12 - Viral antigens
• A61K 39/215 - Coronaviridae, e.g. avian infectious bronchitis virus
• A61P 31/14 - Antivirals for RNA viruses
• C12N 15/62 - DNA sequences coding for fusion proteins

Abstract

in vivo4242-induced neuronal cell death in a subject using such compositions

IPC Classes  ?

• G01N 33/53 - Immunoassay; Biospecific binding assay; Materials therefor
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
• A61P 25/16 - Anti-Parkinson drugs
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

Described herein is a method for diagnosing cancer in a subject, the method comprising determining methylation status at a plurality of CpG sites within a region of a RAD9 gene in DNA present in a urine sample from the subject, wherein an amount of methylation of the plurality of CpG sites that exceeds a threshold indicates that the subject has cancer. Also described are methods of treatment, methods of assessing a methylation status of DNA present in a urine sample obtained from a human subject, methods of detecting methylation or unmethylation of a RAD9 DNA molecule of a human subject, kits, nucleic acid primers, and compositions.

IPC Classes  ?

• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Abstract

Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the "fork reversion and repair" pathway and/or decrease detrimental outcomes such as fork collapse, tranlesion synthesis and/or gap formation. Lastly disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using one or more polynucleotides or polypeptides including but not limited to CHEK1, WEE1, ETAA1, ATRX, BLM, BRCA2, CHD4, DNA2 (DNA2L), EXO1, FANCC, FANCG, FBH1 (FBXO18), HLTF (SMARCA3), MCM9, MSH6, POLD3, POLK, RAD51, RAD52, RAD54L, RBI, RECQL, REV3L, RIF1, RNF8, SETD1A, SHPRH, SMARCAL1, TDRD3, TOPBP1, TP53BP1, WRNIP1, XRCC2, WRN, BRCA1, ZRANB3, CDC6, CDT1, POLH, POLI, FANCD2, INO80, FANCB, ASH2L, FAM35A, XRCC3, BRIP1, and RNF168.

IPC Classes  ?

• C12N 15/873 - Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
• C12N 15/52 - Genes encoding for enzymes or proenzymes
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

A modular system including a pipette including a shaft being configured to be transitioned between a disengaged state and an engaged state, a transport vessel configured to carry tissue cells, the transport vessel including a body extending between a first end and a second end, the body defining a chamber being configured to frictionally engage the shaft to transition the shaft from the disengaged state toward the engaged state, the body being configured to allow the transport vessel to be transitioned between a dismounted position and a mounted position, and a platform including a mounting surface configured to receive the transport vessel to secure the transport vessel in the mounted position, wherein the pipette is capable of moving the transport vessel between the dismounted position and the mounted position when the shaft is in the engaged state.

IPC Classes  ?

• C12M 3/00 - Tissue, human, animal or plant cell, or virus culture apparatus
• B01L 3/02 - Burettes; Pipettes

Abstract

Described herein is a novel mutation in Filamin C (FLNC) in a patient with early onset restrictive cardiomyopathy and utilization of induced pluripotent stem cell derived cardiomyocytes (iPSC-CM) derived from this patient to generate a cell-based model of impaired cardiomyocyte relaxation. In certain aspects, the provided herein are methods of identifying a compound that modulates relaxation velocity of a contractile cell or a beating cardiomyocyte, methods of observing a dynamic physical property of a beating cardiomyocyte, methods of identifying compounds that modulate a dynamic physical property of an engineered cardiac tissue, methods of treating a cardiomyopathy, cell lines, and engineered cardiac tissue.

IPC Classes  ?

• G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
• C12Q 1/025 -
• A61K 31/517 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
• A61P 9/04 - Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure

Abstract

The disclosed matter provides a Contorted Macromolecular Ladders for Fast-charging and Long-Life Lithium Batteries, and the method thereof. By tuning the length of hPDI[n], the electrical and ionic conductivity of the resulting contorted macromolecular ladders can be modulated for improving the lithium-ion coordination and transport. The materials can be applied into organic battery electrode materials which are sustainable, fast-charging, and long lasting.

IPC Classes  ?

• H01M 4/133 - Electrodes based on carbonaceous material, e.g. graphite-intercalation compounds or CFx
• C01B 32/15 - Nanosized carbon materials
• H01G 11/36 - Nanostructures, e.g. nanofibres, nanotubes or fullerenes
• H01M 4/1393 - Processes of manufacture of electrodes based on carbonaceous material, e.g. graphite-intercalation compounds or CFx
• H01M 4/62 - Selection of inactive substances as ingredients for active masses, e.g. binders, fillers
• H01M 4/86 - Inert electrodes with catalytic activity, e.g. for fuel cells
• H01M 4/96 - Carbon-based electrodes
• H01M 10/052 - Li-accumulators

Abstract

The hybrid nanoporous membranes are assembled from inorganic 3D nanospiky particles and polymers, and can be used to filter, capture, and manipulate environmental or biological substances. These materials provide efficient, continuous filtration of ultrasmall biological substances with sizes less than 100 nm while still maintaining air or fluid flow through the materials.

IPC Classes  ?

• B82Y 30/00 - Nanotechnology for materials or surface science, e.g. nanocomposites
• B01D 69/12 - Composite membranes; Ultra-thin membranes
• B01D 71/06 - Organic material
• A41D 13/11 - Protective face masks, e.g. for surgical use, or for use in foul atmospheres

Abstract

Multiple fluorophores within a sample can be imaged by merging a plurality of beams from different wavelength light sources of excitation light into a single path, directing the excitation light into the sample, and detecting light emitted by the fluorophores within the sample on two different arrays of pixels. The light sources are activated during respective timeslots, and captured image data is processed. For at least one of the timeslots, the processing of the image data comprises using the image data captured using the first array of pixels to detect a presence of a given fluorophore, and using the image data captured using the second array of pixels to detect a presence of a different fluorophore.

IPC Classes  ?

• G01N 21/64 - Fluorescence; Phosphorescence
• G02B 23/04 - Telescopes, e.g. binoculars; Periscopes; Instruments for viewing the inside of hollow bodies; Viewfinders; Optical aiming or sighting devices involving prisms or mirrors for the purpose of beam splitting or combining, e.g. fitted with eyepieces for more than one observer
• G02B 21/36 - Microscopes arranged for photographic purposes or projection purposes

Abstract

Disrupting convergence of lytic granules produced by cytotoxic lymphocytes allows non-directional degranulation, improving and broadening killing efficiency of the cytotoxic cells in pathogenic environments such as when used for cancer therapy.

IPC Classes  ?

• A61K 35/17 - Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
• A61K 38/46 - Hydrolases (3)
• C12N 5/0783 - T cells; NK cells; Progenitors of T or NK cells
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C12N 9/22 - Ribonucleases
• A61K 31/517 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine

Abstract

The present disclosure provides for CAR Tregs and Tregs which are both conversion-resistant, i.e., resistant conversion to effector T cells, and condition-resistant, i.e., resistant to a T cell-depleting conditioning regimen involving an antibody, in some instances an anti-CD2 antibody. The disclosed Treg cells are engineered such that they are deficient in or substantially devoid of a cell-surface marker or antigen, i.e., the entire or portion of the gene encoding the cell-surface marker or antigen is deleted from the Treg cell. In some instances, the cell-surface marker or antigen is CD2. The CAR Tregs can comprise a first nucleic acid construct encoding a chimeric antigen receptor (CAR). The present disclosure also provides a one-step method for producing such CAR Tregs and Tregs, using an RNA-guided nuclease. The present disclosure also provides compositions including pharmaceutical compositions comprising the cells, and use of the cells and compositions for therapeutic, prophylactic and diagnostic methods.

IPC Classes  ?

• A61K 35/17 - Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
• A61P 37/02 - Immunomodulators
• C07K 14/705 - Receptors; Cell surface antigens; Cell surface determinants
• C07K 14/70539 -

Abstract

A method for injecting a therapeutic into the inner ear of a subject comprising providing a microneedle having a sharpened distal tip and a shaft with a maximum outer diameter of about 75 microns to about 150 microns, the microneedle defining an inner lumen with a diameter about 15 microns to about 50 microns; the inner lumen having a curvature near the needle tip such that the lumen opened at the side of the needle proximal the needle tip; the microneedle mounted on a blunt metallic syringe needle; the blunt metallic syringe needle attached to a syringe secured to a micropump;_advancing the microneedle into the middle ear space and the perforating the round window membrane (RWM) with the needle tip; extending the needle such that the inner lumen is disposed in the inner ear space; injecting a volume of therapeutic into the inner ear space; and retracting of the microneedle from the RWM.

IPC Classes  ?

• A61F 11/00 - Methods or devices for treatment of the ears or hearing sense ; Non-electric hearing aids; Methods or devices for enabling ear patients to achieve auditory perception through physiological senses other than hearing sense; Protective devices for the ears, carried on the body or in the hand
• A61M 5/00 - Devices for bringing media into the body in a subcutaneous, intra-vascular or intramuscular way; Accessories therefor, e.g. filling or cleaning devices, arm rests
• A61M 5/158 - Needles

Abstract

Compounds for, and methods of, modeling and treating a neurodegenerative disease, including without limitation frontal temporal dementia (FTD), are provided. An effective dose of a pharmaceutical composition is administered to a patient in need thereof, where the pharmaceutical composition targets at least one muscleblind-like protein (MBNL) binding site on exon 10 of microtubule-associated protein tau (MAPT) to block MBNL binding thereto. The at least one MBNL binding site may be 2 binding sites. The pharmaceutical composition may include the nuclease-inactive dCas13d in complex, with one or more guide RNAs, and/or antisense oligonucleotides (ASOs).

IPC Classes  ?

• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• C12N 15/86 - Viral vectors
• C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Abstract

Provided herein are methods of regulating a subject's preference for fat and/or sugar and methods of screening a substance for an ability to activate a nutrient receptor in a subject's gut.

IPC Classes  ?

• A61P 3/00 - Drugs for disorders of the metabolism
• A23L 33/30 -
• A61P 3/04 - Anorexiants; Antiobesity agents
• A23L 33/10 - Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives

Abstract

Treatment of females that experience social isolation-induced anxiety includes administration of an agent that blocks or reduces AVPR1A signaling in the subject. Such agents may interfere with AVPR1A in the amygdala, or specifically in the central nucleus of the amygdala (CeA). Treatment may be administered by injection or by chemogenetic approaches. Compounds that block AVPR1A signaling may be used to accomplish such treatment. Useful compounds include, for example, AVPR1A antagonists such as SRX246.

IPC Classes  ?

• A61P 25/22 - Anxiolytics
• A61P 25/00 - Drugs for disorders of the nervous system
• A61P 25/24 - Antidepressants
• A61P 25/30 - Drugs for disorders of the nervous system for treating abuse or dependence

Abstract

The method of performing multi-modal single-cell and whole-genome sequencing from frozen tissue is a rapid, scalable, and high-quality sequencing method for very small clinical biopsy specimens (on the order of nanograms to micrograms), as well as further providing population-matched ultra-low pass whole-genome sequencing (ulp -WGS). Initially, cell nuclei are extracted from at least one sample. An amplified cDNA library is generated from the extracted cell nuclei, and a gene expression and matching single-nuclei T cell receptor (TCR) library are generated from the amplified cDNA library. Excess nuclei from the at least one sample are collected, and genomic DNA is extracted therefrom. Ultra- low pass whole genome sequencing is then performed on the extracted genomic DNA.

IPC Classes  ?

• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• G16B 30/00 - ICT specially adapted for sequence analysis involving nucleotides or amino acids
• G16B 30/20 - Sequence assembly
• G16B 30/10 - Sequence alignment; Homology search

Abstract

The present disclosure provides to systems, methods, and compositions for template-based DNA. synthesis. Particularly the present disclosure provides systems, methods, and compositions for generating multi-site (e.g., three or more) sequence variants of template nucleic acid strands kilobases (e.g., greater than Ikb) m length.

IPC Classes  ?

• C12N 15/86 - Viral vectors
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• C12P 19/00 - Preparation of compounds containing saccharide radicals
• C12P 19/34 - Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Abstract

Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF ( the "FHF-inhibiting-X-region" (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5'-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3' (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.

IPC Classes  ?

• A61K 35/761 - Adenovirus
• A61P 9/00 - Drugs for disorders of the cardiovascular system
• A61P 9/06 - Antiarrhythmics
• C12N 15/86 - Viral vectors

Abstract

The method of treating obesity and targeting adipose tissue in a patient may use injection of a polycationic polymer, such as polyamidoamine (PAMAM) generation 3 (P-G3) or a PCL-g-PAMAM Denpol, that when delivered intraperitoneally, selectively targets visceral adiposity due to its high charge density. P-G3 treatment of obese mice inhibits visceral adiposity, increases energy expenditure, prevents obesity, and alleviates associated metabolic dysfunctions. The extracellular matrix of adipose tissue is enriched with glycosaminoglycans, the known biomacromolecules with the strongest negative charge. P-G3 uncouples adipocyte lipid synthesis and storage from adipocyte development, creating adipocytes with normal functions but that are deficient in hypertrophic growth. The visceral fat distribution of P-G3 is further enhanced by modifying P-G3 with cholesterol to form lipophilic nanoparticles, effective in treating obesity. This strategy provides a method to target visceral adiposity, and cationic nanomaterials useful for treating metabolic diseases or for delivery of additional treating agents.

IPC Classes  ?

• A61K 47/59 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
• A61K 47/60 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
• A61K 31/132 - Amines, e.g. amantadine having two or more amino groups, e.g. spermidine, putrescine

Abstract

The subject matter described herein relates to methods of zNKT cell activation by the 7DW8- 5 glycolipid.

IPC Classes  ?

• A61K 39/39 - Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
• A61K 39/00 - Medicinal preparations containing antigens or antibodies

Abstract

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH) fibrosis. In one aspect, the disclosed methods relate to targeting a MBOAT7 risk variant, rs641738, in order to increase MBOAT7 expression and down-stream signaling or to silence TAZ. The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH fibrosis and related disorders earlier in disease progression and improve clinical outcomes.

IPC Classes  ?

• A61P 1/16 - Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• A61P 3/00 - Drugs for disorders of the metabolism
• C12N 15/11 - DNA or RNA fragments; Modified forms thereof
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Abstract

A piezoelectric sensor and amplifier for use with an auditory aid device are disclosed. The piezoelectric sensor includes a top sensor and a bottom sensor disposed on opposite surfaces of a flex printed circuit board. The top and bottom sensors are made of a piezoelectric material, such as PVDF. Further, the piezoelectric sensor is adapted to be implanted into a subject's ear, where the piezoelectric sensor is cantilevered with the free, or distal end, touching the umbo. The proximal end is held in place by a support that is affixed to the ear. Additionally, the piezoelectric sensor is shaped so that the width of the distal end is less than the width at the proximal end. Further, the piezoelectric sensor generates differential signals, which are then amplified using a differential amplifier circuit.

IPC Classes  ?

• H04R 25/00 - Deaf-aid sets
• A61N 1/36 - Applying electric currents by contact electrodes alternating or intermittent currents for stimulation, e.g. heart pace-makers
• A61F 2/18 - Internal ear or nose parts, e.g. ear-drums
• A61F 11/20 - Ear surgery
• H02N 2/18 - Electric machines in general using piezoelectric effect, electrostriction or magnetostriction producing electrical output from mechanical input, e.g. generators
• H10N 30/30 - Piezoelectric or electrostrictive devices with mechanical input and electrical output, e.g. functioning as generators or sensors

Abstract

A microneedle system is provided including a needle assembly having a microneedle with a longitudinal body with a diameter of about 50 microns to about 200 microns, the microneedle defining a sharpened tip and a proximal end thereof, the microneedle having first and second lumens extending therethrough, each of the first and second lumens having a distal openings located proximal to the sharpened tip and a proximal opening at a proximal end of the microneedle; a base having a distal end and a proximal end, the distal end of the base coupled to the proximal end of the microneedle and defining first and second passages in fluid communication with the first and second lumens; and a pair of tubes coupled to the base, each tube in fluid communication with a respective first and second passage of the base; a syringe pump; and circulation tubing connecting the syringe pump with the pair of tubes in the needle assembly.

IPC Classes  ?

• A61M 37/00 - Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin
• A61M 5/00 - Devices for bringing media into the body in a subcutaneous, intra-vascular or intramuscular way; Accessories therefor, e.g. filling or cleaning devices, arm rests
• A61M 5/158 - Needles
• A61M 5/32 - Syringes - Details - Details of needles pertaining to their connection with syringe or hub; Accessories for bringing the needle into, or holding the needle on, the body; Devices for protection of needles
• A61F 11/00 - Methods or devices for treatment of the ears or hearing sense ; Non-electric hearing aids; Methods or devices for enabling ear patients to achieve auditory perception through physiological senses other than hearing sense; Protective devices for the ears, carried on the body or in the hand

Abstract

The present subject matter relates to devices and techniques for reducing the parabolic velocity profile. The disclosed device can include a coflow generator configured to receive a buffer solution and a mixture of at least two components to form a coflow pattern in a tubing, and a coflow separator configured to seperate the buffer solution from the reaction mixture. The coflow generator and the coflow separator can be coupled through the tubing. The tubing can be configured to receive the mixture and the buffer solution from the coflow generator and have the mixture bounded by the buffer solution without contacting a wall of the tubing.

IPC Classes  ?

• B01L 3/00 - Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
• G01N 15/14 - Electro-optical investigation
• G01N 15/10 - Investigating individual particles

Abstract

The present subject matter relates to devices and techniques for preparing a sample. The disclosed device can include a mixer, a reaction channel, and a micro sprayer. The mixer can be configured to mix at least two components and perform a splitting and recombination (SAR) mixing. The micro sprayer can be configured to generate a droplet of the sample. The mixer and the micro sprayer can be coupled through the reaction channel. The reaction channel can be a microcapillary tubing or a yin-yang reaction channel.

IPC Classes  ?

• C08L 83/04 - Polysiloxanes
• C08L 83/06 - Polysiloxanes containing silicon bound to oxygen-containing groups
• C09C 3/12 - Treatment with organosilicon compounds
• C08K 9/06 - Ingredients treated with organic substances with silicon-containing compounds
• C08K 9/04 - Ingredients treated with organic substances

Abstract

Disclosed herein are methods of treating and/or prophylaxis of a disease or condition associated with cellular stress granule formation in a mammal via administration of small molecule compounds. Also disclosed herein are chemical compounds effective in treating diseases or conditions associated with aberrant cellular stress responses and/or stress granule formation.

IPC Classes  ?

• A61K 31/095 - Sulfur, selenium or tellurium compounds, e.g. thiols
• A61K 31/505 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
• A61K 31/33 - Heterocyclic compounds
• A61K 31/395 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins

Abstract

Provided herein are recombinant miniature swine without expression of endogenous porcine CD47 and SIRPA, but with the expression of human or humanized CD47 and human or humanized SIRPA under the same regulatory elements as the endogenous porcine CD47 and SIRPA. Also provided are cells, tissues, and organs derived from such recombinant miniature swine. Furthermore, provided herein are methods of transplanting a graft from a first donor of such recombinant miniature swine with or without bone marrow from a second donor of such recombinant miniature swine.

IPC Classes  ?

• A01K 67/027 - New breeds of vertebrates
• A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
• C07K 14/705 - Receptors; Cell surface antigens; Cell surface determinants

Abstract

Disclosed are systems and methods for motor control using piecewise affine modelling. An electronic controller may determine current values for a motor in a rotational reference frame. Each current value may be associated with a dimension of a set of dimensions of the rotational reference frame. The electronic controller may further determine, based on the current values, a flux linkage value for each of the set of dimensions of the rotational reference frame using a piecewise affine map. The electronic controller may further determine a target flux linkage value for each of the set of dimensions of the rotational reference frame. The electronic controller may then control a power switching network coupled between a power supply and the motor based on the flux linkage values and the target flux linkage values.

IPC Classes  ?

• H02P 21/08 - Indirect field-oriented control; Rotor flux feed-forward control
• H02P 21/10 - Direct field-oriented control; Rotor flux feed-back control
• H02P 21/14 - Estimation or adaptation of machine parameters, e.g. flux, current or voltage
• H02P 21/24 - Vector control not involving the use of rotor position or rotor speed sensors
• H02P 21/26 - Rotor flux based control
• H02P 21/06 - Rotor flux based control involving the use of rotor position or rotor speed sensors
• H02P 21/13 - Observer control, e.g. using Luenberger observers or Kalman filters
• H02P 21/22 - Current control, e.g. using a current control loop
• H02P 21/28 - Stator flux based control
• H02P 21/30 - Direct torque control [DTC] or field acceleration method [FAM]
• H02P 6/34 -  Modelling or simulation for control purposes

Abstract

The present disclosure provides to systems, methods, and compositions for rescuing protein misfolding and preventing protein aggregation. Particularly the present disclosure provides methods and compositions comprising DNAJB6 or variants thereof, or polynucleotides encoding DNAJB6 or variants thereof. The present disclosure also provides methods for treating protein misfolding and/or protein aggregation diseases (e.g., multiple amyotrophic lateral sclerosis and frontotemporal dementia) by administering the systems or compositions to a subject in need thereof.

IPC Classes  ?

• A61K 38/16 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
• A61K 38/17 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans
• A61K 38/00 - Medicinal preparations containing peptides

Abstract

A microneedle system for use with a micro-endoscope having a suction tubing coupled to a camera scope portion, the system including a needle assembly comprising: a microneedle defining a tip and a base; a support member having a distal end and a proximal end, the microneedle base mounted on the distal end of the support member, and flexible tubing, the proximal end of the support member affixed to the flexible tubing; wherein the suction tubing defines an interior lumen, a bend at the distal end portion thereof and a distal edge that is non-orthogonal to the linear axis of the tubing, such that the distal end portion is visible within the camera field of view, and wherein the needle assembly is received within the interior lumen of the suction tubing such that the microneedle is extendable from the distal end of the suction tubing and visible within the camera field of view.

IPC Classes  ?

• A61B 1/227 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor for ears, i.e. otoscopes
• A61B 17/00 - Surgical instruments, devices or methods, e.g. tourniquets

Abstract

System, apparatus, method and computer-accessible medium according to exemplary embodiments of the present disclosure which facilitate accessible, data-driven neuroimaging. Exemplary embodiment of the present disclosure provides for a magnet, a gradient, and spectrometer technology that can be contained in an imaging suite that can be affordably manufactured, delivered, and operated anywhere in the world by a trained field nurse. Exemplary networks of these field-deployed MR suites can be tethered to a remote resource base such as a hospital through satellite links to a cloud platform. In exemplary embodiments, massive amounts of heterogeneous data can be collected from diverse populations in a standardized way and archived for machine learning approaches to permit model-based inference generation.

IPC Classes  ?

• A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
• G01R 33/54 - Signal processing systems, e.g. using pulse sequences
• G01R 33/565 - Correction of image distortions, e.g. due to magnetic field inhomogeneities
• G01R 33/20 - Arrangements or instruments for measuring magnetic variables involving magnetic resonance
• A61B 5/0515 - Magnetic particle imaging
• G16H 30/20 - ICT specially adapted for the handling or processing of medical images for handling medical images, e.g. DICOM, HL7 or PACS
• G16H 30/40 - ICT specially adapted for the handling or processing of medical images for processing medical images, e.g. editing

Abstract

The epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) osimertinib has significantly prolonged progression-free survival (PFS) in EGFR-mutant lung cancer patients, including those with brain metastases. However, osimertinib-treated patients often develop lethal metastatic relapse, often to the brain. The genetic repression of S100A9, ALDH1A1, or RA receptors (RAR) in cancer cells, or treatment with a pan-RAR antagonist, dramatically reduces brain metastasis. S100A9 expression in cancer cells correlates with poor PFS in osimertinib-treated patients, and is identified as a novel, therapeutically targetable S100A9-ALDH1A1-RA axis. A combination of osimertinib and AGN-194310, for example, treats such cancer while avoiding metastatic relapse.

IPC Classes  ?

• A61P 35/04 - Antineoplastic agents specific for metastasis
• A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
• A61P 35/00 - Antineoplastic agents
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Abstract

The present disclosure provides methods of treating and preventing trigeminal nerve pain with modulators of oxidative stress (e.g., NRF2 transcription network activators and/or inhibitors of transient receptor potential ankyrin 1 (TRPA1)) and compositions thereof.

IPC Classes  ?

• A61K 31/56 - Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
• A61K 31/565 - Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. oestrane, oestradiol
• C07J 1/00 - Normal steroids containing carbon, hydrogen, halogen, or oxygen, not substituted in position 17 beta by a carbon atom, e.g. oestrane, androstane

Abstract

Methods and compositions for treating leukemia involving administering a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase (IDO1). The leukemia may be is acute myeloid leukemia or acute lymphoid leukemia. The inhibitor can be a small molecule such as indiximod, epacadostat, BMS-986205, navoximod, PF-0684003, KHK2455 or LY3381916 or epacadostat. The inhibitor can be used alone or in conjunctions with other chemotherapeutic agents. IDO1 can also be inhibited using a CRISP-CAS system. The inhibitor can be administered orally, intravenously, intramuscularly, topically, arterially, or subcutaneously.

IPC Classes  ?

• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
• A61K 39/39 - Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
• C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals

Abstract

The subject matter described herein relates to a method of treating cancer in a subject in need thereof using a bispecific molecule recognizing two antigen markers of different tissue lineages on the surface of The First Cell.

IPC Classes  ?

• A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
• A61K 47/68 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
• A61P 35/00 - Antineoplastic agents
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C07K 16/46 - Hybrid immunoglobulins
• C07K 14/705 - Receptors; Cell surface antigens; Cell surface determinants
• C12N 15/02 - Preparation of hybrid cells by fusion of two or more cells, e.g. protoplast fusion

Abstract

The present disclosure relates to the use of therapeutic agents to prevent and/or treat neurodegenerative disorders. The methods include prevention and/or treatment of neurodegenerative disorders with the administration of the disclosed therapeutic agents to a subject. The present disclosure further provides compositions and kits for performing such methods.

IPC Classes  ?

• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• A61P 3/06 - Antihyperlipidemics
• A61P 9/10 - Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• A61P 1/16 - Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
• A61K 31/713 - Double-stranded nucleic acids or oligonucleotides

Abstract

Encoding environmental parameters by modulating swarm patterns of bacteria on substrates and correlating spatiotemporal changes in the environmental parameters to changes in swarm patterns using one or more trained machine learning models.

IPC Classes  ?

• C12Q 1/04 - Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
• G01N 21/64 - Fluorescence; Phosphorescence
• C12N 1/20 - Bacteria; Culture media therefor
• C12N 15/74 - Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Abstract

Disclosed herein are methods for regulating an immune response using selective activation of neurons in the caudal nucleus of the solitary tract.

IPC Classes  ?

• C07K 14/705 - Receptors; Cell surface antigens; Cell surface determinants
• G16B 15/30 - Drug targeting using structural data; Docking or binding prediction
• A61P 25/00 - Drugs for disorders of the nervous system
• A61P 37/04 - Immunostimulants

Abstract

A biphasic microcapsule comprising a core and a shell encapsulating the core, wherein the core comprises dextran and the shell comprises photopolymerized poly(ethylene glycol) diacrylate (PEGDA) and related compositions and methods.

IPC Classes  ?

• A61K 9/50 - Microcapsules
• B01J 13/20 - After-treatment of capsule walls, e.g. hardening
• A61K 9/52 - Sustained or differential release type
• B01J 13/18 - In situ polymerisation with all reactants being present in the same phase

Abstract

A method of producing microbial biocellulose from a bacteria can comprise pre-culturing at least one bacteria in Hestrin-Schramm (HS) medium at a temperature of 20-40 °C for 50-80 hours under a static condition, and inoculating at least one carbon source at a concentration between 1% and 15% with pre-cultured bacteria obtained in step (a) at a temperature of 20-40 °C for 10-20 days under static condition.

IPC Classes  ?

• A61L 15/28 - Polysaccharides or their derivatives
• A61L 27/20 - Polysaccharides
• A61L 15/22 - Bandages, dressings or absorbent pads for physiological fluids such as urine or blood, e.g. sanitary towels, tampons containing macromolecular materials
• A61L 31/04 - Macromolecular materials
• A61L 27/14 - Macromolecular materials

Abstract

2255, PLGA and PLC.

IPC Classes  ?

• C03C 4/00 - Compositions for glass with special properties
• A61L 27/10 - Ceramics or glasses
• A61L 27/02 - Inorganic materials

Abstract

The present subject matter relates to techniques for passive acoustic mapping. The disclosed system can include a focused ultrasound (FUS) transducer, a diagnostic phase array transducer, and a processor. The diagnostic phase array transducer can be configured to receive a cavitation signal induced from cavitation. The processor can be configured to generate a cavitation map based on a spatio-temporal cavitation intensity. The spatio-temporal cavitation intensity can be calculated using a spatial-temporal parallel programming. The spatial-temporal parallel programming can be performed by creating a thread for each pixel of the spatial-temporal map, calculating the spatio-temporal cavitation intensity at a location and a time point in each thread, and creating a cavitation map by integrating the spatial-temporal cavitation intensity over temporal pixels.

IPC Classes  ?

• A61B 8/00 - Diagnosis using ultrasonic, sonic or infrasonic waves
• A61B 17/00 - Surgical instruments, devices or methods, e.g. tourniquets
• A61N 7/02 - Localised ultrasound hyperthermia
• A61B 34/10 - Computer-aided planning, simulation or modelling of surgical operations

Abstract

The present disclosure provides systems and methods for isolation of nucleic acids. In particular, provided herein are nanopore-based or substrate-based sequencing systems and methods of use thereof for isolation of desired nucleic acids from a mixed library containing both accurate and inaccurate strands.

IPC Classes  ?

• C12Q 1/6816 - Hybridisation assays characterised by the detection means
• C12Q 1/6825 - Nucleic acid detection involving sensors
• C12Q 1/6869 - Methods for sequencing
• G01N 27/26 - Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by using electrolysis or electrophoresis
• G01N 33/487 - Physical analysis of biological material of liquid biological material
• B82Y 15/00 - Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors

Abstract

The invention discloses a method to co-culture patient-derived tumor organoids and the corresponding patient's tumor-infiltrating lymphocytes from a tumor sample.

IPC Classes  ?

• G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
• C12M 1/34 - Measuring or testing with condition measuring or sensing means, e.g. colony counters
• C12N 5/09 - Tumour cells

Abstract

Methods to prevent, inhibit or treat a neurodegenerative disease, e.g., one having protein aggregates, as well as compositions useful in that regard, are provided.

IPC Classes  ?

• A61K 38/17 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

A method of treating essential tremor (ET) includes administering a calcium channel stabilizer to a patient in need thereof. The calcium channel stabilizer enhances or restores the binding of leaky RyR1 with calstabin-1 in brain cells, and thereby inhibits endoplasmic reticulum (ER)-calcium leak. Further, the brain cells may comprise cerebellum cells, or the brain cells may comprise Purkinje cells. Inhibiting ER-calcium leak ameliorates ET and reduces cerebellar oscillatory activity.

IPC Classes  ?

• A61K 31/33 - Heterocyclic compounds
• A61K 31/55 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
• C07D 281/02 - Seven-membered rings
• C07D 281/08 - Seven-membered rings having the hetero atoms in positions 1 and 4 condensed with carbocyclic rings or ring systems

Abstract

Anti-SARS-CoV-2 α/β-polypeptides, pharmaceutical compositions containing the same, and methods to inhibit, treat, and ameliorate SARS-CoV-2 infections in mammals, including humans.

IPC Classes  ?

• A61K 39/215 - Coronaviridae, e.g. avian infectious bronchitis virus
• C07K 14/165 - Coronaviridae, e.g. avian infectious bronchitis virus
• A61P 31/14 - Antivirals for RNA viruses
• A61P 11/00 - Drugs for disorders of the respiratory system

Abstract

Geobacillus spGeobacillus sp. bacterial strain are provided which are capable of effectively degrading 1,4-dioxane and/or per- and polyfluoroalkyl substances (PFAS) and/or BaP and efficiently degrading other ring-based organic contaminants. The exemplary bioremediation methods include steps for administering an effective, degrading amount of the bacteria to soil containing excess amounts of 1,4-dioxane and/or PFAS and/or BaP and incubating the bacteria administered to the soil at a given temperature and for a duration that are suitable for promoting incubation and reducing and the concentration of 1,4-dioxane and/or PFAS and/or BaP below a maximum concentration, as might be specified by a regulatory body.

IPC Classes  ?

• C02F 3/34 - Biological treatment of water, waste water, or sewage characterised by the microorganisms used
• B09C 1/10 - Reclamation of contaminated soil microbiologically or by using enzymes
• C12N 1/20 - Bacteria; Culture media therefor

Abstract

The disclosed subject matter provides for genetically modified cells, e.g., fungal cells, that autonomously generates and/or secretes one or more skin therapeutics, and methods of use thereof. In certain embodiments, the present disclosure provides genetically-engineered fungal cells that generate and secrete growth factors, protease inhibitors, cytokines and/or chemokines and methods of use thereof, e.g., for treating skin conditions.

IPC Classes  ?

• A61K 36/06 - Fungi, e.g. yeasts
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 38/00 - Medicinal preparations containing peptides
• A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• C12N 1/14 - Fungi ; Culture media therefor
• C12N 15/18 - Growth hormones
• C12N 15/19 - Interferons; Lymphokines; Cytokines
• C12N 15/81 - Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts

Abstract

Methods for treating muscle loss and exercise capacity pathologies by controlling osteocalcin release, and compositions therefor, are provided.

IPC Classes  ?

• A61K 38/20 - Interleukins
• A61K 47/64 - Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
• C07K 14/54 - Interleukins (IL)

Abstract

A method of treating tissue, the method comprising: applying a biochemical agent to a surface of a target tissue, and pulsing low intensity focused acoustic waves from an acoustic energy source toward the target tissue, such that the low intensity focused acoustic waves are pulsed at a frequency and amplitude that does not induce boiling or cavitation of the target tissue, thereby selectively removing cells of the target tissue by the low intensity acoustic waves, while leaving healthy cells of the target tissue substantially intact.

IPC Classes  ?

• A61B 17/22 - Surgical instruments, devices or methods, e.g. tourniquets for removing obstructions in blood vessels, not otherwise provided for

Abstract

The present disclosure provides a compound having the structure : and methods of us ing the compound in activating 5HT2A receptor in a subject with low or no hallucinogenic effects.

IPC Classes  ?

• A61K 31/33 - Heterocyclic compounds
• A61K 31/435 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
• A61K 31/4545 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine

Abstract

A method of increasing or decreasing expression of a target mRNA and protein for treatment of certain disease conditions by cells having a pre-mRNA that comprises a poison exon and encodes the target protein, and can include contacting the cells with an antisense oligomer (ASO) complementary to a targeted portion of the pre-mRNA.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides